Vaccination – vaccinering

Förr har det alltid hetat vaccination. Numera har det alltmer gått över till vaccinering. Varför?

Jag tycker inte att man i oträngt mål ska byta ut ett ord som har varit etablerat i hundra år ?!

 

Comments

  1. 1
    Ann-Christin Bragason säger

    Rätt! Det är ett otyg att byta namn på saker i tid och otid.

  2. 2
    Mats Blomqvist säger

    Jag har en liten tanke om detta, fick den då jag läste ditt inlägg Annika (vill tillägga att jag inte är “kunnig” inom hälsa och medicin, däremot har jag fått lite hum om saker och ting genom mycket googlande). Om följande, rätta mig om jag har fel:
    Har hittat två eller tre rapporter skrivna av läkare där man säger att detta inte är ett vaccin utan snarare en kemisk komponent (minns inte exakta ordet de använde), nanopartikel. Tydligen finns det en teknisk definition på vad ett vaccin är, kanske genom framtagningsmetoden(?). Genom då att i detta fall skriva vaccinering kan man tänka sig att man anspelar på att det är fråga om vaccination, det räcker i alla fall för att den inte medicinkunnige medelsvensson ska tänka vaccin.
    Vaccin är ju till för att motverka angrepp av främmande organismer, medan detta s.k. “RMA-vaccin” är till för att förändra vårt DNA. Dessutom innebär ju ändrat DNA att det handlar om GMO, dvs genmanipulation. Jämför man då Monsantos GMO-förändring av plantor, där Monsanto äger de frön som man “säljer” till bonden, med GMO i våra celler så kan man tänka sig att “RMA-vaccinets” ägare (läs: Bill G) äger oss. Så helt plötsligt så är vi slavar (detta är taget ur en artikel jag hittade).

  3. 3
    Lars Henrik säger

    Jag undrar om det inte helt enkelt handlar om en naturlig språkförändring över tid? Jag gjorde för skojs skull en Google-sökning på “vaccination” och “vaccinering” samt “2010” och kunde hitta en del artiklar från det året (2010) där bägge orden förekom i samma text.

    Bägge orden är substantiv och verkar ha varit i bruk en längre tid.

    https://sv.m.wiktionary.org/wiki/vaccination
    https://sv.m.wiktionary.org/wiki/vaccinering

  4. 4

    Jag har upptäckt en extrem vilja att göra om stavningen på ord ex. Khadaffi, Gadaffi så att de skall skilja sig från engelskans ord. Är detta en medveten strategi? Vad är syftet?

    Island verkar länge ha gjort detta medvetet på ett sätt som gör att orden ska skilja sig extremt mycket från andra språk.

  5. 5

    Orden är ett riktmärke över samhällsutvecklingen. Det ena är ett substantiv som man kan prata om och välja om man vill ha. Det andra är mer adverbialt och mer av en uppmaning. Det är en gåva från staten som man tacksamt ska ta emot om man är en solidarisk människa. Annars är man ett ruttet ägg i korgen.

    2. Intressant! När ett helt nytt ämne konstrueras med uppgift att påverka skapelsens grundsten, DNA-molekylen, Då är människan ute på tunn is över djupa vatten. Förmodligen är DNA-molekylen något som någon skapare hittat på. Det är en programmering för naturen och tillvaron. Ett budskap om självutveckling. Ett meddelande som kommer från en kedja av meddelanden sedan tidernas begynnelse.Vi är nu mottagare av dessa meddelanden från förhistorien och har förmedlat dem vidare till våra barn.

    Planeten har tidigare blivit påverkad av DNA-teknik. Rymdvarelser kom för länge sedan och klippte och klistrade ihop en människa av de varelser som då vandrade här på jorden. Ett sant mästerverk, trots sina skavanker, genomförda av en mästerlig vetenskapsman. Som även gav sin skapelse det likaså, genmodifierade vetet, tillsammans med plogen. För att människan skulle få en smidig mat att livnära sig på. När när människan stretar mellan 9 och 5, för sin brödföda.

    Konsekvensen av denna genmodulering kan vi nu konstatera 300 tusen år senare. Genmanipulering har enorma följdverkningar för planeten. Och man ska inte manipulera den utan att först veta vad det är och var det kommer ifrån.

    När ett vaccin framställs ska det dokumenteras och presenteras i grunden, pedagogiskt för de som ska utsättas för experimentet. Vi vet inte ett sk-t om detta vaccin?!? Vad det är och vad det gör.

    Ingen panik, jag hörde att om man tar alla vaccinerna så har man ett gott skydd i säkert 6 månader. Sedan har viruset muterat så mycket att vi måste modifiera vacccinerna och ta dem igen. 2 gggr per år i 20 år framöver. Det är dags att investera i läkemedelsaktier. Det är uppenbart att det är framtiden.

    Lite BS från antispråkpolisen (:

  6. 6
    Lars Henrik säger

    @Martin,

    På Island är språkvård väldigt viktigt. De värnar sitt fornnordiska arv, medvetna som de är om att de är de enda kvarvarande som talar fornnordiska (eller i varje fall ett mycket närbesläktat språk). De värjer sig från låneord således.

  7. 7

    #2 Mats Blomqvist
    Du har rätt. De insprutningar av medel från Pfizer och Moderna (P&M) är inga vacciner. Vacciners funktioner är att direkt skapa immunrespons och stoppa transmission av en patogen. P&M stoppar inte transmission. Funktionen är istället att producera en patogen som immunförsvaret ska reagera på. Detta sker genom att förstöra den normala cellfunktionen, även hos fullt friska personer. De kan därför på visst sätt sägas vara cytostatisk adjuvans behandling. Vem ger cytostatika som profylax till en person som inte har eller har haft cancer? Såklart ingen, men behandlingen med P&M har vissa likheter, eftersom avsikten är att förstöra den normala cellfunktionen.
    P&M är dock inga läkemedel enligt dess normala klassningssystem. De är kemiska behandlingar som påverkar genfunktionerna. Eftersom de är kemiska behandlingsterapier bör den kloke efterfråga alternativa behandlingsterapier. Detta är helt enligt läkarkodexen, som den aktuella läkaren, som är ansvarig för injektionerna, bör kunna erbjuda. Om inte, och den ansvarige läkaren inte kan friskriva patienten biverkningsfri injektion bör man avstå från behandling, enligt mitt förstånd. Skälet är att biverkningarna är outforskade och potentiellt multipla, enligt nedanstående förklaring.
    • P&Ms injektion avser att manipulera muskelceller (förstöra och ge ny funktion) till att fungera som fabrik för en ‘patogen’, enkannerligen den S-gen, ett glykoprotein, som utgör spetsen i virionsytan (‘spikprotein’) i ‘viruset’ Sars-Cov2. Detta protein anges vara mycket specifikt för det aktuella ‘viruset’. Eftersom ingen vet så noga kan ett svagt immunsystem överreagera när väl dessa glykoproteiner kommer i omlopp. Det som är speciellt farligt sammanhänger med att den aktuella S-genen inte alls är specifik för Sars-Cov2. Dess sekvens av nukleinsyror är:
    TTGGCAAAATTCAAGACTCACTTTC, om jag rätt uppfattat det.
    Vid sökningar som gjorts i Basic Local Alignment Search Tool (BLAST) har man funnit med 100% sekvensmatchning hos 86 humana kromosomfragment. Varför är detta viktigt?
    Om immunsystemet går amok kan det gå lös på dessa kromosomdelar i det humana DNAt och orsaka stor förödelse på icke avsett sätt.
    Vem vill riskera det? Inte jag i alla fall.
    Det finns säkrare preventiva behandlingsterapier, som direkt syftar till att förstärka immunsystemets kapacitet och kapabilitet. Detta ger ortomolekylärfysiologer gärna.

  8. 8

    Normalt inte emot vacciner. Nu har vi ett vaccin som är skapat i “warp-speed”.
    Jag är skeptisk till detta nya vaccin av naturliga orsaker.

  9. 9

    Hur förhåller det sig med den etiska aspekten av att utestänga människor från normala samhällsaktiviteter såsom restaurangbesök, sport och kulturevenemang, researrangemang? Det talas också om att arbetsgivare kan avskeda personal som väljer att avstå vaccinering.
    Dokumentationen av en medicinsk behandling – vilket en vaccination måste ses som- är en del av en patients sekretessbelagda patientjournal? Är det nu fritt fram för vem som helst att begära utdrag ur dessa journaler?
    Vart är vi på väg med dessa frågor? Är det verkligen numer fritt fram i Sverige att diskriminera människor som väljer att avstå medicinsk behandling – en behandling med en substans som det saknas erfarenhet av och där vetenskapen saknar både svar och erfarenhet av långtidseffekterna?

  10. 10
  11. 11
    Lars Henrik säger

    @Jala 10,
    Bra tips!

  12. 12

    @10,

    Märkligt att det inte blivit mer känt. Artikeln är från 20/7 förra året.

  13. 13
  14. 14
    Lars Henrik säger

    @Stefan:
    Upogiften kommer tydligen från Dagens Medicin. När jag surfade dit hittade jag denna uppmuntrande artikel. Tyvärr bakom betalvägg men första delen lyder:

    Stöd för kolhydratsnål kost vid diabetes
    Nya data talar för att vissa personer med typ 2-diabetes kan få bättre sjukdomsbild med en diet som är fattig på kolhydrater – i alla fall på kort sikt.

    En sådan kost under sex månaders tid kopplades till högre förekomst av remission, det vill säga att blodsockernivåerna förbättrades. Även andra fördelar sågs, såsom viktnedgång och lägre nivåer av triglycerider.

  15. 15

    Mera stöd för kolhydrat restriktion.

    https://www.wheatbellyblog.com/about/

  16. 16
  17. 17
  18. 18

    Till 17:

    Lars Bern är inte vetenskapligt utbildad inom
    området och skall ses mot den bakgrunden.

  19. 19
    Nisse Hult säger
  20. 20

    @ 18

    Kanske duger Dr Mercola bättre. Dessutom är han inte Ryss.

  21. 21
    Nisse Hult säger

    @ 20

    Kan Sverige/FHM/Hallengren/mfl ta ordet ” Vaccin som inte är ett Vaccin” i munnen och torgföra detta seriöst?

  22. 22

    @ 21

    Det finns inget seriöst i det gänget.

Speak Your Mind

*

Denna webbplats använder Akismet för att minska skräppost. Lär dig hur din kommentardata bearbetas.